Olives Description of molecular data (SSR)

Molecular description of olive (Olea europaea L.) includes results of microsatellites analysis, carried out according to the standard procedures1,2,3,4. Microsatellites (SSR; Simple Sequence Repeats) are short nucleotide tandem repeats in DNA sequences, typically from one to six nucleotides per unit. The number of repeats is variable in populations of DNA and within the alleles of an individual. Microsatellite profile is determined by allele sizes (in base pairs; bp) on analysed genetic loci. Microsatellite markers today represent the most common choice for the cultivar identification, and those used in the analysis of Croatian olive cultivars are presented in the table.

SSR locus SSR locus
(short name)
Repeat motif Primer sequence (5′-3′) Allele size (bp)
(literature data)
ssrOeUA-DCA031 DCA03 (GA)19 CCCAAGCGGAGGTGTATATTGTTAC
TGCTTTTGTCGTGTTTGAGATGTTG
232-255
ssrOeUA-DCA041 DCA04 (GA)16 CTTAACTTTGTGCTTCTCCATATCC
AGTGACAAAAGCAAAAGACTAAAGC
128-186
ssrOeUA-DCA081 DCA08 (GA)18 ACAATTCAACCTCACCCCCATACCC
TCACGTCAACTGTGCCACTGAACTG
123-139
ssrOeUA-DCA091 DCA09 (GA)23 AATCAAAGTCTTCCTTCTCATTTCG
GATCCTTCCAAAAGTATAACCTCTC
162-210
ssrOeUA-DCA141 DCA14 (AC)18(A)6(TAA)7 AATTTTTTAATGCACTATAATTTAC
TTGAGGTCTCTATATCTCCCAGGGG
173-191
ssrOeUA-DCA161 DCA16 (GT)13(GA)29 TTAGGTGGGATTCTGTAGATGGTTG
TTTTAGGTGAGTTCATAGAATTAGC
124-174
ssrOeUA-DCA181 DCA18 (CA)4CT(CA)3(GA)19 AAGAAAGAAAAAGGCAGAATTAAGC
GTTTTCGTCTCTCTACATAAGTGAC
163-187
GAPU71B2 GAPU71B (AG)8(AAG)12 GATCAAAGGAAGAAGGGGATAAA
ACAACAAATCCGTACGCTTG
121-144
EMO903 EMO90 (CA)10 CATCCGGATTTCTTGCTTTT
AGCGAATGTAGCTTTGCATGT
186–198

1Sefc KM, Lopes MS, Mendonça D, Rodrigues Dos Santos M, Laimer Da Câmara Machado M, Da Câmara Machado A. 2000. Molecular Ecology 9(8), 1171-1173.
2Carriero F, Fontanazza G, Cellini F, Giorio G. 2002. Theoretical and Applied Genetics 104(2-3), 301-307.
3De la Rosa R, James CM, Tobutt KR. 2002. Molecular Ecology Notes 2, 265-267.
4Baldoni L, Cultrera NG, Mariotti R, Ricciolini C, Arcioni S, Vendramin GG, Buonamici A, Porceddu A, Sarri V, Ojeda MA, Trujillo I, Rallo L, Belaj A, Perri E, Salimonti A, Muzzalupo I, Casagrande A, Lain O, Messina R, Testolin R. 2009. Molecular Breeding 24(3), 213-231.